pcag gal4 dbd gbp2 vector (Addgene inc)
Addgene inc is a verified supplier 
92
Structured Review
Addgene inc
pcag gal4 dbd gbp2 vector
Pcag Gal4 Dbd Gbp2 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcag+gal4+dbd+gbp2+vector/pCAG-Gal4DBD-GBP2+(Plasmid+%2349439)/pmc07261253-1318-5-7
Average 92 stars, based on 4 article reviews
Pcag Gal4 Dbd Gbp2 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcag+gal4+dbd+gbp2+vector/pCAG-Gal4DBD-GBP2+(Plasmid+%2349439)/pmc07261253-1318-5-7
Average 92 stars, based on 4 article reviews
pcag gal4 dbd gbp2 vector - by Bioz Stars,
2026-09
92/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: Unblending of transcriptional condensates in human repeat expansion disease Article Snippet: IDR-mCherry forward primer: taccggtgacagtggatccggagctac RUNX2 IDR-mCherry forward primer: taccggtGGaagagaggccACTAGTGC IDR-mCherry reverse primer: cgcaagcttcttgtacaattcatccatgc In the GAL4-DBD luciferase system, GAL4 DBD-IDR fusion constructs were expressed from a backbone of GAL4-DBD expression vector [GI-GAL4-DBD (Addgene 42500)], from which GI-GAL4 sequence was removed with EcoRI and XbaI digestion. .. GAL4-DBD was PCR amplified from Amplification:Article Title: Unblending of transcriptional condensates in human repeat expansion disease Article Snippet: IDR-mCherry forward primer: taccggtgacagtggatccggagctac RUNX2 IDR-mCherry forward primer: taccggtGGaagagaggccACTAGTGC IDR-mCherry reverse primer: cgcaagcttcttgtacaattcatccatgc In the GAL4-DBD luciferase system, GAL4 DBD-IDR fusion constructs were expressed from a backbone of GAL4-DBD expression vector [GI-GAL4-DBD (Addgene 42500)], from which GI-GAL4 sequence was removed with EcoRI and XbaI digestion. .. GAL4-DBD was PCR amplified from Cloning:Article Title: Unblending of transcriptional condensates in human repeat expansion disease Article Snippet: IDR-mCherry forward primer: taccggtgacagtggatccggagctac RUNX2 IDR-mCherry forward primer: taccggtGGaagagaggccACTAGTGC IDR-mCherry reverse primer: cgcaagcttcttgtacaattcatccatgc In the GAL4-DBD luciferase system, GAL4 DBD-IDR fusion constructs were expressed from a backbone of GAL4-DBD expression vector [GI-GAL4-DBD (Addgene 42500)], from which GI-GAL4 sequence was removed with EcoRI and XbaI digestion. .. GAL4-DBD was PCR amplified from Plasmid Preparation:Article Title: Unblending of transcriptional condensates in human repeat expansion disease Article Snippet: IDR-mCherry forward primer: taccggtgacagtggatccggagctac RUNX2 IDR-mCherry forward primer: taccggtGGaagagaggccACTAGTGC IDR-mCherry reverse primer: cgcaagcttcttgtacaattcatccatgc In the GAL4-DBD luciferase system, GAL4 DBD-IDR fusion constructs were expressed from a backbone of GAL4-DBD expression vector [GI-GAL4-DBD (Addgene 42500)], from which GI-GAL4 sequence was removed with EcoRI and XbaI digestion. .. GAL4-DBD was PCR amplified from |